FASTQ-Format
FASTQ Format
| FASTQ format | |
|---|---|
| Dateiendung: | .fastq
|
| Entwickelt von: | Wellcome Trust Sanger Institute |
| Erstveröffentlichung: | ~2000 |
| Art: | Bioinformatik |
| Erweitert von: | ASCII and FASTA format |
| https://maq.sourceforge.net/fastq.shtml | |
Das FASTQ-Format ist ein textbasiertes Format zum Speichern einer biologischen Sequenz (meist Nukleotidsequenz) und ihrer entsprechenden Qualitätskennzahlen. Sowohl der Sequenzbuchstabe als auch die Qualitätskennzahl sind mit einem einzigen ASCII-Zeichen codiert.
Es wurde ursprünglich am Wellcome Trust Sanger Institute entwickelt, um eine Sequenz im FASTA-Format mit ihren Qualitätsdaten zu verbinden und gemeinsam abzuspeichern. Das Format ist aber mittlerweile zum Standard für die Speicherung von high-throughput Sequenzdaten geworden[1].
Format
Eine FASTQ-Datei hat vier Zeilen pro Sequenz:
- Zeile 1 beginnt mit einem „@“-Zeichen, gefolgt von einer Sequenzkennung und einer optionalen Beschreibung (wie eine FASTA-Titelzeile).
- Zeile 2 beinhaltet die Sequenzbuchstaben.
- Zeile 3 beginnt mit einem „+“-Zeichen und kann optional dieselbe Sequenzkennung (und eine beliebige Beschreibung) aufweisen.
- Zeile 4 codiert die Qualitätskennzahlen für die Sequenz in Zeile 2 und muss die gleiche Anzahl an Symbolen enthalten wie Buchstaben in der Sequenz sind.
Eine FASTQ-Datei mit einer einzigen Sequenz kann folgendermaßen aussehen:
@SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
Einzelnachweise
- ↑ Peter J. A. Cock, Christopher J. Fields, Naohisa Goto, Michael L. Heuer, Peter M. Rice: The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants. In: Nucleic Acids Research. Band 38, Nr. 6, April 2010, ISSN 1362-4962, S. 1767–1771, doi:10.1093/nar/gkp1137, PMID 20015970, PMC 2847217 (freier Volltext).
Weblinks
- MAQ webpage discussing FASTQ variants
Content Disclaimer
Informasi ini disarikan dari Wikipedia dan disajikan kembali untuk tujuan edukasi. Konten tersedia di bawah lisensi CC BY-SA 3.0. Kami tidak bertanggung jawab atas ketidakakuratan data yang bersumber dari kontribusi publik tersebut.
- The information displayed on this website is sourced in part or in whole from Wikipedia and has been adapted for the purpose of restating it. We strive to provide accurate and relevant information, however:
- There is no guarantee of absolute accuracy. Wikipedia is an open, collaborative project that can be edited by anyone, so information is subject to change.
- It is not intended to constitute professional advice. The content displayed is for informational and educational purposes only. For important decisions (e.g., medical, legal, or financial), please consult a professional.
- Content copyright. Wikipedia is licensed under the Creative Commons Attribution-ShareAlike License (CC BY-SA). This means that content may be reused with appropriate attribution and shared under a similar license.
- Responsible use. Any risk arising from the use of information from this website is entirely the responsibility of the user.