Search Results: File:Clustal Omega Algorithm Flowchart.svg
Sorry, the article you're looking for isn't specifically available. Here are related topics:
File:TMEM116 Vertebrates MSA.pdf
Jumat, 2026-06-05 23:43:09between the human TMEM116 protein and its vertebrate orthologs generated using Clustal Omega. author name string: Mahmo186 Wikimedia username: Mahmo186...
Click to read more »File:Histone Alignment.png
Kamis, 2025-05-01 20:44:05org/licenses/by/4.0CC BY 4.0 Creative Commons Attribution 4.0 truetrue Clustal FAQ #Symbols. Clustal. Retrieved on 8 December 2014. English Wikimedia username: Evolution...
Click to read more »File:RPLP0 90 ClustalW aln.gif
Kamis, 2026-02-19 21:40:05Representation of a protein [[multiple sequence alignment]] produced with [[ClustalW]]. The sequences are instances of the acidic [[ribosomal protein]] P0...
Click to read more »File:Alineación de secuencias proteicas en diferentes organismos.png
Rabu, 2025-07-16 10:22:12aminoácidos, estos se muestran en colores representativos llamado sistema Clustal author name string: AndreaHdzz Wikimedia username: AndreaHdzz URL: https://commons...
Click to read more »File:Fam158a Homolog Chemistry Alignment.png
Senin, 2023-02-13 05:40:24I generated this alignment using the ClustalW program and then a shading program. I collected the sequence information from NCBI, which provides free...
Click to read more »File:Fam158a Homolog Identity Alignment.png
Senin, 2025-10-27 03:35:17Alignment that I generated using a program (ClustalW: Thompson J.D., Higgins D.G., Gibson T.J. "CLUSTAL W: improving the sensitivity of progressive multiple...
Click to read more »File:Complete mitochondrial genome of Oberea diversipes (Coleoptera, Cerambycidae).pdf
Senin, 2024-04-08 20:09:13mitogenomes from Chrysomelidae as outgroups. The 13 individual PCGs were aligned CLUSTAL W (Thompson et al. 1994) within MEGA6 (Tamura et al. 2013), and the conserved...
Click to read more »File:TMEM247ParalogAlignment.png
Selasa, 2026-02-10 13:24:13BY-SA 4.0 Creative Commons Attribution-Share Alike 4.0 truetrue English CLUSTAL O(1.2.4) multiple sequence alignment of ''TMEM247'' and its paralog, ''hCG17037''...
Click to read more »File:Developing a library for proofs of data possession in Charm (IA developinglibrar1094534728).pdf
Sabtu, 2026-04-25 20:08:28Publishing, 2008, p 376. [18] src/clustal/util.c File Reference. Aug. 31, 2012. Available: http://www.clustal.org/omega/clustalo-api/util_8c.html....
Click to read more »File:Unrooted Phylogenetic Tree Generated by TMEM269 Protein Orthologs.png
Rabu, 2025-12-24 13:14:12unrooted phylogenetic tree generated using sequences of TMEM269 orthologs via Clustal Omega Prediction Tool author name string: Luke.Stavedahl Wikimedia username:...
Click to read more »File:Annotated TMEM131L Protein.jpg
Kamis, 2025-07-10 02:17:43(NP_001124479.1)and conservation analysis using SDSC Biology Workbench: CLUSTAL W program I, the copyright holder of this work, hereby publish it under...
Click to read more »File:Proceedings of the Linnean Society of New South Wales (IA proceedingsoflin119linn).pdf
Minggu, 2024-07-21 05:18:58-520 (Thompson et al. 1994). base pair unit. Sequences were aligned using Clustal Unrooted phylogenies, with Cherax specified as the outgroup, were estimated...
Click to read more »File:Marine mammal skin microbiotas are influenced by host phylogeny.pdf
Sabtu, 2025-04-19 07:18:12e1003531. (doi:10.1371/journal.pcbi.1003531) Larkin MA et al. 2007 Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947–2948. (doi:10.1093/bioinformatics/btm404)...
Click to read more »File:Chitinase genes from Metarhizium anisopliae for the control of whitefly in cotton.pdf
Senin, 2025-12-01 08:52:28analysis (NCBI; http://www.ncbi/ BLAST; [27]) and ClustalW software (htpp://www.ch.embnet.org/software/ClustalW.html; [28]) were used to compare the Chit1 sequence...
Click to read more »File:Clustal esquema.jpg
Jumat, 2026-01-23 19:30:15DescriptionClustal esquema.jpg Català: Passes que segueix l’algorisme del software ClustalW pels alineaments globals. Date 20 December 2020 Source Own...
Click to read more »File:Esquema clustal cat.jpg
Selasa, 2026-02-03 18:58:21DescriptionEsquema clustal cat.jpg Català: Esquema dels passos que segueix ClustalW Date 20 December 2020 Source Own work Author TorresBH...
Click to read more »File:Clustal esquema català.jpg
Jumat, 2026-01-23 19:30:14DescriptionClustal esquema català.jpg Català: Passes que segueix l’algorisme del software ClustalW pels alineaments globals. Date 20 December 2020, 12:42:40...
Click to read more »File:Clustal (Thompson, 1994).jpg
Minggu, 2025-06-15 04:05:28DescriptionClustal (Thompson, 1994).jpg Čeština: Základní metoda z roku 1994 (Thompson, 1994). Jako zdrojová data 7 globinů známé terciární struktury...
Click to read more »File:Into the dark - patterns of middle ear adaptations in subterranean eulipotyphlan mammals.pdf
Sabtu, 2025-04-19 06:26:137, 1–12. (doi:10.18637/jss.v007.i10) 75. Larkin MA et al. 2007 Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947–2948. (doi:10.1093/ bioinformatics/btm404)...
Click to read more »File:Clustal Omega Algorithm Flowchart.svg
Jumat, 2024-03-22 14:08:13DescriptionClustal Omega Algorithm Flowchart.svg English: Flowchart depicting the step-by-step algorithm used in Clustal Omega. Date 23 April 2018 Source...
Click to read more »File:Protein alignment.jpg
Kamis, 2024-11-14 10:20:48four different hemoglobin protein sequences. The alignment made by using ClustalW WWW Service at the European Bioinformatics Institute (http://www.ebi.ac...
Click to read more »File:Clustal (Chenna, 2003) 1.jpg
Jumat, 2024-03-22 14:08:10DescriptionClustal (Chenna, 2003) 1.jpg Čeština: Multiple alignment čtyř oxidoreduktáz, proteinové sekvence NAD vázajících domén. Date 5 May 2016 Source...
Click to read more »File:Steps outlining the Clustal Omega algorithm.png
Minggu, 2026-03-08 10:44:50DescriptionSteps outlining the Clustal Omega algorithm.png English: Flowchart that shows step-by-step what the Clustal Omega algorithm uses to produce...
Click to read more »File:Clustal (Chenna, 2003) 2.jpg
Jumat, 2024-03-22 14:08:11DescriptionClustal (Chenna, 2003) 2.jpg Čeština: Fylogenetický strom vytvořen Clustalem W . Chenna, 2003 Date 5 May 2016 Source Own work Author Tomcalob...
Click to read more »File:Peckhamia 116.1.pdf
Minggu, 2025-04-20 01:54:40conducted in MEGA for MacOS X (release #6140220). Alignment was done by Clustal method. Multiple alignments were executed with gap opening/gap extension...
Click to read more »File:Viruses-13-00027-v2 - Isolation and Characterization of Salmonella Jumbo-Phage pSal-SNUABM-04.pdf
Jumat, 2025-09-26 22:17:18jumbo phages were obtained from the GenBank database and aligned using Clustal W [10]. For single genome phylogeny analysis, we used sequences of the...
Click to read more »File:Izumo1 and Juno - the evolutionary origins and coevolution of essential sperm–egg binding partners.pdf
Sabtu, 2025-04-19 06:46:31Acids Res. 41, D8–D20. (doi:10.1093/nar/gks1189). Li K-B. 2003 ClustalW-MPI: ClustalW analysis using distributed and parallel computing. Bioinformatics...
Click to read more »File:C17orf50 promoter sequence.pdf
Jumat, 2024-01-12 11:28:41binding sites ttctccagcccatcaacttgcctccaccaaacttagatgcccaaaggaag 1 2 ClustalW [http://www.genome.jp/tools-bin/clustalw], accessed 28 March 2018 BoxShade...
Click to read more »File:Invasive mutualisms between a plant pathogen and insect vectors in the Middle East and Brazil.pdf
Sabtu, 2025-04-19 06:26:30Figure 3. Phylogenetic tree using neighbour-joining method constructed by Clustal W (MEGA5 v. 5.05) comparing 16S rDNA sequence from our Phyllantus maderaspatensis...
Click to read more »File:Development of genetic markers for environmental DNA (eDNA) monitoring of sturgeon - USACE-p266001coll1-3853.pdf
Sabtu, 2026-04-25 20:34:16A. Wilm, J. D. Thompson, T. J. Gibson, and D. G. Higgins. 2007. ClustalW and ClustalX version 2.0. Bioinformatics 23(21):2947-2948. Software available...
Click to read more »File:Clustal Omega Amino Acid Alignment Chart of SST.png
Minggu, 2026-05-24 08:45:57DescriptionClustal Omega Amino Acid Alignment Chart of SST.png English: Sequence alignment of SST and its cleaved products. Date 11 February 2026 Source...
Click to read more »File:Characterizing genetic diversity in Colorado River cutthroat trout- Identifying Lineage GB populations - USACE-p16021coll7-659.pdf
Senin, 2025-11-24 19:24:59edited (removed) from the ends of the fragments. Sequences were aligned in ClustalW (Thompson et al. 1994) and compared to the suite of genetic diversity...
Click to read more »File:Opsin genes of select treeshrews resolve ancestral character states within Scandentia.pdf
Sabtu, 2025-08-23 12:50:27OPN1SW and OPN1LW sequences in Geneious v. 10.0.3 (Biomatters) using the Clustal W function with manual refinement. We aligned them to opsin sequences from...
Click to read more »File:Historical gene flow constraints in a northeastern Atlantic fish - phylogeography of the ballan wrasse Labrus bergylta across its distribution range.pdf
Sabtu, 2025-04-19 05:46:07edited with Codon Code Aligner (Codon Code Corporation) and aligned with Clustal X 2.1 [37]. Whenever possible, both strands of the same specimen were recovered...
Click to read more »File:Flowchart for ClustalW Algorithm.svg
Rabu, 2026-01-28 23:33:10DescriptionFlowchart for ClustalW Algorithm.svg English: Depicts the steps the ClustalW software algorithm uses for global alignments Date 1 May 2018...
Click to read more »File:Leishmania naiffi and Leishmania guyanensis reference genomes highlight genome structure and gene evolution in the Viannia subgenus.pdf
Minggu, 2025-08-24 22:33:26lainsoni MHOM/BR/1981/M6426 (IOC_L1023). The genes were aligned using Clustal Omega v1.1 [61] to create a network for the 102 isolates with SplitsTree...
Click to read more »File:Structures of pyruvate kinases display evolutionarily divergent allosteric strategies.pdf
Minggu, 2025-04-20 02:54:04yeast and bacteria. The sequence alignment was performed using the program Clustal Omega at the European Bioinformatics Institute [3,4]. Domain boundaries...
Click to read more »File:Reduced entomopathogen abundance in Myrmica ant nests—testing a possible immunological benefit of myrmecophily using Galleria mellonella as a model.pdf
Jumat, 2026-03-20 09:26:031055–1073. (doi:10.3852/10-302) Thompson JD, Higgins DG, Gibson TJ. 1994 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment...
Click to read more »File:Phylogeny of Anophelinae using mitochondrial protein coding genes.pdf
Minggu, 2025-04-20 02:00:52homogeneity used p4 ([46], http://p4.nhm.ac.uk). Alignments were made using CLUSTAL OMEGA [47]. Alignments were masked for reliable sites using GBlocks [48]...
Click to read more »File:A new rainfrog of the genus Pristimantis (Anura, Brachycephaloidea) from central and eastern Panama.pdf
Jumat, 2023-06-30 07:10:23e., only one sequence/taxon/location). The sequences were aligned with CLUSTAL W (Larkin et al. 2007) and edited by eye using Geneious version 4.8.5 (Kearse...
Click to read more »File:Lineage-independent retrotransposition of UTP14 associated with male fertility has occurred multiple times throughout mammalian evolution.pdf
Sabtu, 2025-04-19 07:16:47uk/Tools/st/emboss_sixpack/). Multi-sequence alignments were done using either Clustal Omega or T-Coffee, which are available on the EMBL-EBI website (http://www...
Click to read more »File:Maternal effects and Symbiodinium community composition drive differential patterns in juvenile survival in the coral Acropora tenuis.pdf
Sabtu, 2025-04-19 07:21:12similarity were calculated for these OTUs using the package ‘ape’ [63] and Clustal Omega [64] with Geneious [65], respectively. (a) 8 * (WO, p < 10–4)...
Click to read more »File:Depth specialization in mesophotic corals (Leptoseris spp.) and associated algal symbionts in Hawaii.pdf
Senin, 2025-12-29 04:36:20SEQUENCHER v. 4.7 (Gene Codes Corporation, Ann Arbor, MI, USA), aligned with CLUSTAL W implemented in BIOEDIT v. 5.0.9 [53] and manually refined. Three main...
Click to read more »File:Molecular phylogeny of Culex subgenus Melanoconion (Diptera - Culicidae) based on nuclear and mitochondrial protein-coding genes.pdf
Sabtu, 2025-04-19 07:31:11amino acids for each of the three datasets. All alignments were made using Clustal W, implemented in Geneious version R 9.0 (default parameters), and adjusted...
Click to read more »File:Combining genetic and distributional approaches to sourcing introduced species - a case study on the Nile monitor (Varanus niloticus) in Florida.pdf
Senin, 2025-04-21 08:25:29the species’ native range in Africa. We aligned all DNA sequences using Clustal-W [41] implemented in MEGA 6 [42]. Haplotype reconstruction of nuclear...
Click to read more »File:Molecular identification of Oesophagostomum spp. from 'village' chimpanzees in Uganda and their phylogenetic relationship with those of other primates.pdf
Selasa, 2025-12-30 17:07:25(doi:10.1093/molbev/msr121) Thompson JD, Higgins DG, Gibson TJ. 2004 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment...
Click to read more »File:Takeout gene expression is associated with temporal kin recognition.pdf
Minggu, 2025-04-20 03:00:27Reticulitermes speratus [24], Bombyx mori and Anopheles gambiae [25], and using Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo/) and produced plots with...
Click to read more »File:Effects of the inclusion of a mixed Psychrotrophic bacteria strain for sewage treatment in constructed wetland in winter seasons.pdf
Selasa, 2026-06-02 18:31:35strains, and the phylogenetic tree was analysed and constructed by using Clustal W and PHYLIP software. The phylogenetic tree is shown in figure 3. According...
Click to read more »File:Phylogeography of hydrothermal vent stalked barnacles - a new species fills a gap in the Indian Ocean ‘dispersal corridor’ hypothesis.pdf
Minggu, 2025-04-20 02:00:52of the International Nucleotide Sequence Database Collaboration, using Clustal X included in MEGA v. 6.06 [35]. A total of 123 sequences from seven eolepadid...
Click to read more »File:Unexpected monophyletic origin of Ephoron shigae unisexual reproduction strains and their rapid expansion across Japan.pdf
Minggu, 2025-04-20 04:47:39WORKBENCH software (CLC bio, Aarhus, Denmark), and crosschecked them by a CLUSTAL W [23] algorithm implemented in MEGA5.10 [24]. The PHASE algorithm [25...
Click to read more »File:A pair of non-optimal codons are necessary for the correct biosynthesis of the Aspergillus nidulans urea transporter, UreA.pdf
Senin, 2025-04-21 05:38:37Database (http://www.aspgd.org/) [72]. Protein sequences were aligned using CLUSTAL OMEGA v.1.2.4 [73] and back translated to the known nucleotide coding sequence...
Click to read more »File:A new species of Eupithecia Curtis (Lepidoptera, Geometridae) from the Andes of northern Chile.pdf
Senin, 2025-06-09 23:00:48procedures described in Hebert et al. (2004). The sequences were aligned with ClustalW in MEGA X (Kumar et al. 2018) to search for variable sites and were analyzed...
Click to read more »File:Multiple Sequence Alignment Using ClustalW.jpg
Senin, 2026-02-02 11:37:05DescriptionMultiple Sequence Alignment Using ClustalW.jpg English: Multiple sequence alignment ofCDK4protein generated with ClustalW. Arrows indicate point mutations...
Click to read more »File:Opsin transcripts of predatory diving beetles - a comparison of surface and subterranean photic niches.pdf
Sabtu, 2025-08-23 12:54:03sequences (excluding unalignable putative UTR) were first aligned with CLUSTAL OMEGA [41]; best-hit dytiscid transcripts were manually aligned to the...
Click to read more »File:Mechanistic insights into molecular evolution of species-specific differential glycosaminoglycan binding surfaces in growth-related oncogene chemokines.pdf
Selasa, 2026-03-31 21:01:22alignment for the nucleotide sequences of GRO chemokines was generated using CLUSTAL Omega (https://www.ebi.ac.uk/Tools/msa/clustalo/) by employing default...
Click to read more »File:An integrative taxonomic analysis reveals a new species of lotic Hynobius salamander from Japan.pdf
Jumat, 2025-09-26 06:10:04respectively. Phylogenetic analyses Sequences were aligned using the Clustal W algorithm (Thompson, Higgins & Gibson, 1994) in BioEdit Sequence Alignment...
Click to read more »File:Parasite (journal) 2013, 20, 2 Grover - HSP70.pdf
Jumat, 2025-09-19 18:59:26PfHsp70-1 (cytosolic), PfHsp70-2 (ER) and PfHsp70-3 (mitochondrial) using ClustalW. Red: putative signal peptide, blue: EEVD/EEVN motif, green: peptide used...
Click to read more »File:Taxonomy assignment approach determines the efficiency of identification of OTUs in marine nematodes.pdf
Minggu, 2025-04-20 03:00:38trimmed to the barcoding region and aligned with query sequences using the ClustalW [45] algorithm at default settings implemented in MEGA v. 7 [46]. The...
Click to read more »File:S41598-019-44038-0.pdf
Sabtu, 2023-01-07 03:18:39BEDtools20, SAMtools17 and GATK18. We created two sequence alignments using ClustalW21, applying default settings, which included the 16 reference panel samples...
Click to read more »File:Differential phenotypic and genetic expression of defence compounds in a plant–herbivore interaction along elevation.pdf
Senin, 2025-04-21 14:42:11supplementary material, figure S1), sequence alignment was performed using the ClustalW algorithm implemented in Bioedit 7.0 [55], followed by minor manual correction...
Click to read more »File:GuUGT, a glycosyltransferase from Glycyrrhiza uralensis, exhibits glycyrrhetinic acid 3- and 30-O-glycosylation.pdf
Sabtu, 2026-05-23 18:06:28analysis The amino acid sequences of the candidate UGTs were aligned using ClustalW and MEGA 7.0.14 (https:// www.megasoftware.net/) was used to construct...
Click to read more »File:How did a duplicated gene copy evolve into a restorer-of-fertility gene in a plant? The case of Oma1.pdf
Sabtu, 2025-04-19 05:47:38cgi). Alignment of nucleotide and amino acid sequences was done using ClustalW (http://clustalw.ddbj. nig.ac.jp/index.php?lang=ja) and MEGA (https://www...
Click to read more »File:Phylogenetic evidence for the ancient Himalayan wolf - towards a clarification of its taxonomic status based on genetic sampling from western Nepal.pdf
Minggu, 2025-04-20 02:00:50reference sequences from NCBI GenBank. Sequences were aligned using the ClustalW algorithm implemented in GENEIOUS v. 8.1.8 to a consensus length of 242...
Click to read more »File:A Revision of the Stylasteridae (Cnidaria, Hydrozoa, Filifera) from Alaska and Adjacent Waters.pdf
Minggu, 2025-02-09 12:57:24described in Cunningham and Buss (1993). Sequences were aligned using ClustalX (Thompson et al. 1997) and phylogenetic analyses were performed in PAUP*...
Click to read more »File:Water, water everywhere - environmental DNA can unlock population structure in elusive marine species.pdf
Minggu, 2025-04-20 05:10:45captures phylogenetically informative sites. Primer design was based on a ClustalW alignment of 58 known North Pacific harbour porpoise haplotypes from sequence...
Click to read more »File:Functional characterization of three flavonoid glycosyltransferases from Andrographis paniculata.pdf
Jumat, 2025-10-10 23:58:46analysis DNAMAN software was used to carry out the multiple alignment. ClustalW analysis software was used to compare the amino acid sequences of the...
Click to read more »File:Diversity of management strategies in Mesoamerican turkeys - archaeological, isotopic and genetic evidence.pdf
Sabtu, 2026-05-02 15:55:53archaeological turkey remains recovered from the American Southwest [19] using ClustalW [44] through BioEdit [45] and Network (v. 5.0) [46]. 3. Results 3.1....
Click to read more »File:Seven new species of Night Frogs (Anura, Nyctibatrachidae) from the Western Ghats Biodiversity Hotspot of India, with remarkably high diversity of diminutive forms.pdf
Sabtu, 2025-05-03 01:33:16S1. Alignment was created in MEGA 6.0 (Tamura et al., 2013) using the ClustalW tool and manually optimised. The resultant DNA matrix (540 bp) was executed...
Click to read more »File:S41467-019-11690-z.pdf
Selasa, 2024-10-08 20:45:20CodonCode Aligner (www.codoncode.com) and preliminarily aligned using ClustalW in MEGA 6.0.6.40. Alignments were checked by eye and manually adjusted...
Click to read more »File:S41467-020-15507-2.pdf
Minggu, 2026-03-29 19:12:04github.com/faylward/ncldv_markersearch). Alignments were created using ClustalOmega, and trimAl was used for trimming (parameter -gt 0.1). We ran IQ-TREE73...
Click to read more »File:Revue suisse de zoologie (IA revuesuissede12132014schw).pdf
Senin, 2022-12-05 00:50:18I). The obtained sequences were initially automatically aligned using ClustalW (Thompson et al, 1994) and manually checked using the original chromatograph...
Click to read more »File:MSA 3'UTR miRNA.png
Minggu, 2021-01-17 21:07:44DescriptionMSA 3'UTR miRNA.png English: the Clustal MSA for miRNA conservation of 3'UTR Date 18 December 2020 Source Own work Author Rade0120...
Click to read more »File:Protein alignment.svg
Kamis, 2020-10-29 13:04:23Accession number to the left, obtained from GenBank, alignment using ClustalΩ at the EBI webservice. Deutsch: Multiples Alignment von vier Hämoglobin-Sequenzen...
Click to read more »File:Profile Hidden Markov Model.png
Rabu, 2026-01-28 00:32:51English: The structure of a profile HMM used in the implementation of Clustal Omega is shown here. Date 5 February 2001 Source http://www.biology.wustl...
Click to read more »File:LeuTseq.jpg
Minggu, 2026-05-24 02:08:20comparison between LeuT and human serotonin transporter, generated using Clustal Omega. Date 23 October 2014, 20:20:27 Source Own work Author BQUB14-Nsaez...
Click to read more »File:C1orf21 Tree.png
Kamis, 2025-10-09 11:33:53Tree made with a Neighbor-Joining method using a ClustalW-formatted set of sequences as input1.1 Clustal W <https://www.genome.jp/tools-bin/clustalw> Date...
Click to read more »File:Human Keratins 1-8 Protein Alignment Rod Domain.tif
Jumat, 2024-12-06 17:27:31Keratin 1,2A,3,4,5,6A,7,and 8 (KRT1 - KRT8). Alignment was created using Clustal Omega (tool available online). Date 17 April 2014 Source Own work Author...
Click to read more »File:Phylogenetic tree for Hp53int1.png
Rabu, 2026-02-18 01:08:13for Hp53int1.png English: The phylogenetic tree of Hp53int1 and its orthologs using Clustal W Date 15 December 2022 Source Own work Author Megpayne35...
Click to read more »File:Distant Orthologs Box Shade.pdf
Jumat, 2026-05-01 19:04:26DescriptionDistant Orthologs Box Shade.pdf English: Box Shade Clustal MSA of Distant Orthologs Date 29 October 2020 Source Own work Author Asim16...
Click to read more »File:Evolutionary History of DEPDC1B with Paralogs (DEPDC1A and DEPDC7).gif
Sabtu, 2025-08-09 18:07:56Date 3/21/14 Source Higgins, D.G., Bleasby, A.J. and Fuchs, R. (1992) CLUSTAL V: improved software for multiple sequence alignment. Computer Applications...
Click to read more »File:Phylogeny of FAM46 in Orthologs and Homologs.png
Senin, 2026-03-23 00:58:03selective orthologs and homologs. Date 9 May 2013, 02:05:31 Source ClustalW Author CLUSTAL W: Julie D. Thompson, Desmond G. Higgins and Toby J. Gibson,...
Click to read more »File:Alignment of UBact and Pup from the bacterium Leptospirillum ferrodiazotrophum.png
Selasa, 2023-08-01 21:03:52from the bacterium Leptospirillum ferrodiazotrophum were aligned with Clustal Omega to assess their similarity. Date 18 July 2017 Source Own work Author...
Click to read more »File:Multiple Sequence Alignment of Distant PROSER3 Orthologs.png
Senin, 2026-02-16 02:39:42planci, Exaiptasia diaphana, Haliotis rubra, and Oscarella lobularis using Clustal Omega software. Date 4 December 2024 Source Own work Author Kenzie208...
Click to read more »File:Multiple Sequence Alignment of TMEM269 Protein with Close Orthologs of Humans.png
Jumat, 2023-06-02 19:14:24encoded. (according to the boundaries in the human version). Generated using Clustal Omega Alignment Tool. Date 13 December 2022 Source Own work Author Luke...
Click to read more »File:Sequence alignment.jpg
Rabu, 2022-07-27 06:12:23comparison between human serotonin transporter and LeuT, generated using Clustal Omega. Date 23 October 2014, 20:05:08 Source Own work Author BQUB14-Nsaez...
Click to read more »File:Zinc-finger-seq-alignment2.png
Rabu, 2025-04-02 21:13:47English: Sequence alignment produced with the freely available program ClustalW between two zinc finger protein sequences publicly available in GenBank...
Click to read more »File:Unrooted Phylogenetic Tree of ZNF800 Orthologs.png
Kamis, 2025-10-02 20:44:27DescriptionUnrooted Phylogenetic Tree of ZNF800 Orthologs.png English: This tree from Clustal W shows an unrooted phylogenetic tree of the ZNF800 orthologs showing relatedness...
Click to read more »File:ConSurf color coded multiple sequence alignment structure of Frogs, Snakes and Human.png
Selasa, 2024-04-09 05:50:06built using MAFFT. The homologs were collected from UNIREF90. After the Clustal Omega alignment was run into the ConSurf. Date 9 May 2022 Source Own work...
Click to read more »File:Human SCRN3 and Invertebrate Ortholog Multiple Sequence Alignment.png
Minggu, 2025-10-26 01:06:53region and exon boundaries determined from Homo sapiens SCRN3 sequence. Created using Clustal Omega Date 7 December 2022 Source Own work Author Acrz28...
Click to read more »File:Multiple Sequence Alignment of Distant PROSER3 Orthologs pt.2.png
Kamis, 2025-03-06 17:44:17planci, Exaiptasia diaphana, Haliotis rubra, and Oscarella lobularis using Clustal Omega software. Date 4 December 2024 Source Own work Author Kenzie208...
Click to read more »File:Fam158a and Cox4NB alignment.png
Senin, 2022-05-02 02:01:14and Cox4NB alignment.png English: This is an alignment I generated using ClustalW and a shading program to annotate conserved regions. The sequences are...
Click to read more »File:Human SCRN3 Paralog Multiple Sequence Alignment.png
Selasa, 2025-08-12 20:53:13PepD region and exon boundaries determined from Homo sapiens SCRN3 sequence. Made using Clustal Omega Date 7 December 2022 Source Own work Author Acrz28...
Click to read more »File:MSA colors.png
Selasa, 2025-11-18 02:44:18окрасок множественного выравнивания различных белков семейства YpzG, визуализация в Jalview, выравнивание ClustalWS. Source Own work Author GGleb42WP...
Click to read more »File:ZNF226 Ortholog Multiple Sequence Alignment 5.png
Kamis, 2025-08-07 19:51:33Ortholog Multiple Sequence Alignment 5.png English: Using EMBOSS-EMBL, Clustal Omega and SAPS program, a multiple sequence alignment of human ZNF226 and...
Click to read more »File:ZNF226 Ortholog Multiple Sequence Alignment 1.png
Kamis, 2025-08-07 19:52:10Ortholog Multiple Sequence Alignment 1.png English: Using EMBOSS-EMBL, Clustal Omega and SAPS program, a multiple sequence alignment of human ZNF226 and...
Click to read more »File:CPU time spent by each program when aligning increasing sequence lengths.png
Rabu, 2024-01-24 06:42:19tested sequence sizes. T-Coffee was the slowest program, taking longer than Clustal W, MAFFT (FFT-NS-2 and L-INS-i), Kalign, and POA for the smallest sequence...
Click to read more »File:ZNF226 Ortholog Multiple Sequence Alignment 4.png
Kamis, 2025-08-07 19:51:25Ortholog Multiple Sequence Alignment 4.png English: Using EMBOSS-EMBL, Clustal Omega and SAPS program, a multiple sequence alignment of human ZNF226 and...
Click to read more »File:ZNF226 Ortholog Multiple Sequence Alignment 2.png
Kamis, 2025-08-07 19:57:41Ortholog Multiple Sequence Alignment 2.png English: Using EMBOSS-EMBL, Clustal Omega and SAPS program, a multiple sequence alignment of human ZNF226 and...
Click to read more »File:CCDC132 Stict Ortho.pdf
Rabu, 2025-05-07 22:15:49UCSD Biology workbench, a free analysis tool. Date Unknown date Source ClustalW protein alignment in UCSC Biology work Bench Author Unknown authorUnknown...
Click to read more »File:Pbio.0020429.g001 (14134357941).png
Sabtu, 2025-12-20 23:01:07(14134357941).png Drosophila Spastin: Sequence Alignment and Gene Map (A) Clustal alignment of complete D. melanogaster and H. sapiens Spastin amino acid...
Click to read more »File:ZNF226 Ortholog Multiple Sequence Alignment 3.png
Kamis, 2025-08-07 19:57:16Ortholog Multiple Sequence Alignment 3.png English: Using EMBOSS-EMBL, Clustal Omega and SAPS program, a multiple sequence alignment of human ZNF226 and...
Click to read more »File:Fpls-03-00022-g001 (14237449089).jpg
Selasa, 2024-08-06 18:15:43plant sucrose transporters and homologs. Protein alignment was done using Clustal X. Sequences with greater than 90% identity were not used in construction...
Click to read more »File:An excerpt of a multiple sequence alignment of TMEM66 proteins.png
Rabu, 2023-08-09 10:11:37English: Created with ClustalW using TMEM66 proteins from the public NCBI Protein database. Date 30 April 2013 Source Open source ClustalW and sequences from...
Click to read more »File:Human CXorf65 Strict Ortholog MSA.png
Kamis, 2025-11-20 16:16:29Multiple sequence alignment of strict human CXorf65 orthologs made using Clustal Omega. Sequences include: Homo sapiens (Humans, NP_001020436.1) = Hsap...
Click to read more »File:Strict Annotated Orthlog Alignment P3 TMEM19.png
Sabtu, 2025-12-27 06:16:02(Vertebrates) Multiple Sequence Alignment. Sequences were aligned using ClustalO, transmembrane regions and exons were boxed. Consensus of amino acids...
Click to read more »File:Unrooted phylogenetic tree of C4orf51.png
Rabu, 2024-10-30 18:11:12of C4orf51.png English: Time-calibrated unrooted phylogenetic tree, made with ClustalW and annotated Date 3 March 2019 Source Own work Author 195gupta...
Click to read more »File:Multiple Sequence Alignment.jpg
Jumat, 2020-10-16 19:29:21Sequence Alignment.jpg Bahasa Indonesia: Pensejajaran sekuen jamak menggunakan ClustalW Date 4 April 2014, 05:02:08 Source Own work Author BP59Febri...
Click to read more »File:2022.12.001.gr1AB lrg.jpg
Minggu, 2026-05-24 05:48:31HK106, at protein level, using BLASTp. Protein identities obtained with Clustal Omega are shown for each protein. Date 2 January 2023 Source A widespread...
Click to read more »File:1-s2.0-S0168170213003183-gr2 (14405034756).jpg
Rabu, 2024-06-26 21:44:15analysis are in the Supplemental Material. Alignments were produced by a CLUSTAL algorithm and the dendrogram was produced by CDC Main Workbench software...
Click to read more »File:Phylogenetic Tree of C8ORF48 (Unrooted).jpg
Jumat, 2024-11-15 21:13:19DescriptionPhylogenetic Tree of C8ORF48 (Unrooted).jpg English: Made utilizing the program ClustalW DrawTree on Biology WorkBench. Date 28 February 2016 Source Own work Author...
Click to read more »File:Fimmu-11-00334-g001.jpg
Rabu, 2025-05-28 00:18:25flaviviruses were obtained from the NCBI database and pairwise aligned using Clustal W. The phylogenetic tree was constructed by using the maximum likelihood...
Click to read more »File:C1orf68 Repeat Sequence Conservation LOGO.png
Kamis, 2025-10-09 11:56:44human C1orf68 conserved across select orthologs, obtained by using tools ClustalOmega and WebLogo3. Size of the letters represents the conservation of the...
Click to read more »File:LRRC24 Orthologs Unrooted Tree .png
Rabu, 2025-02-05 02:04:23English: An unrooted phylogenetic tree of LRRC24 orthologs generated using Phylip’s DrawTree and ClustalW. Date 9 May 2016 Source Own work Author Mxfraser...
Click to read more »File:Pbio.0020237.g003 (14137682895).png
Kamis, 2025-11-06 21:34:32bar indicate the number of recombinants identified by SSCP analysis. (B) Clustal-W–generated phylogentic tree of zebrafish (Danio rerio [Dr]) Tif1γ and...
Click to read more »File:Strict Ortholog Multiple Sequence Alignment.pdf
Selasa, 2025-08-12 20:52:23Multiple Sequence Alignment.pdf English: Sequences were aligned using ClustalO, transmembrane regions and exons were boxed. Consensus of amino acids...
Click to read more »File:Strict Annotated Orthlog Alignment P2 TMEM19.png
Selasa, 2025-08-12 20:52:20(Vertebrates) Multiple Sequence Alignment. Sequences were aligned using ClustalO, transmembrane regions and exons were boxed. Consensus of amino acids...
Click to read more »File:Strict Annotated Orthlog Alignment TMEM19.png
Selasa, 2025-08-12 20:52:25(Vertebrates) Multiple Sequence Alignment. Sequences were aligned using ClustalO, transmembrane regions and exons were boxed. Consensus of amino acids...
Click to read more »File:Multiple Sequence Alignment of NOXRED Paralogs.png
Sabtu, 2023-08-19 08:54:06DescriptionMultiple Sequence Alignment of NOXRED Paralogs.png English: Created using ClustalOmega. Date 11 December 2022 Source Own work Author Gamccabe...
Click to read more »File:2022.12.001.gr1 lrg.jpg
Jumat, 2024-12-06 16:30:28HK106, at protein level, using BLASTp. Protein identities obtained with Clustal Omega are shown for each protein. (C) Distribution of wGRR values between...
Click to read more »File:TMEM89 N-myristoylation site alignment.png
Rabu, 2025-11-19 23:35:46TMEM89 multiple sequence alignment with N-myristoylation site made with Clustal Omega. Labels: Sarc_TMEM89, Sarcophilus harrisii (Tasmanian devil); Tric_TMEM89...
Click to read more »File:Zika-Virus-the-Latest-Newcomer-fmicb-07-00496-g003.jpg
Rabu, 2025-05-28 00:38:34complete NS5 nucleotide sequence, built from a multiple alignment using Clustal omega and Phylogeny.fr (Dereeper et al., 2008). Date 19 April 2016 Source...
Click to read more »File:Autosomal-Recessive-Transmission-of-a-Rare-KRT74-Variant-Causes-Hair-and-Nail-Ectodermal-Dysplasia-pone.0093607.g002.jpg
Rabu, 2025-07-16 14:41:49-Hair-and-Nail-Ectodermal-Dysplasia-pone.0093607.g002.jpg English: (A) Clustal Omega alignment of part of Keratin-74 shows complete evolutionary conservation...
Click to read more »File:Zika-Virus-the-Latest-Newcomer-fmicb-07-00496-g004.jpg
Sabtu, 2025-09-13 20:00:33complete NS5 nucleotide sequence, built from a multiple alignment using Clustal omega and Phylogeny.fr. Date 19 April 2016 Source Image file from Saiz...
Click to read more »File:TMEM89 Multiple Sequences Alignment.png
Senin, 2023-07-10 16:32:40used were found using Protein BLAST on NCBI. Multiple sequence alignment made with Clustal Omega. Date 17 October 2022 Source Own work Author Ak01a5...
Click to read more »File:1-s2.0-S1567134813003729-gr3 (14424526301).jpg
Rabu, 2025-08-13 02:17:26all T6SS clusters. The whole T6SS nucleotide sequences were aligned with ClustalW, and the MEGA software version 5.0 was used to perform a 2000 bootstrap...
Click to read more »File:ODR.Birna.Fig4.v7.png
Selasa, 2025-12-09 14:55:16(Shi et al., 2016, Shi et al., 2018)). Amino acid alignment was done with ClustalW (Larkin et al., 2007) and adjusted visually. Phylogenetic analysis was...
Click to read more »File:Pastedimage1529073491255v2.png
Sabtu, 2022-09-24 00:55:59RNA3 of isolates of 7 ophiovirus species. Alignment was obtained using ClustalW, and analyzed by the neighbor-joining method, with 1000 bootstrap replicates...
Click to read more »File:Pbio.0040186.g003 (14137947154).png
Minggu, 2024-12-01 23:42:25gp47. Multiple sequence alignment of these proteins was performed using ClustalW (identical residues indicated by an asterisk [*]) and the phylogenetic...
Click to read more »File:Pbio.0040003.g003 (13951033959).png
Jumat, 2024-07-05 16:50:29sequences were aligned with 21 known PMMV CP genes from GenBank using ClustalW with default parameter settings. In this phylogenetic tree of the PMMV...
Click to read more »File:Pbio.0050004.g001 (13951047499).png
Senin, 2024-11-04 23:01:11and represented by family names. The phylogenetic tree was generated by ClustalW and PHYLIP programs. Both bootstrap support (the number of times each...
Click to read more »File:Strict orthologs msa for c11orf97.png
Kamis, 2025-12-18 00:45:23alignment are from mammals, birds, and reptiles. This alignment was made using ClustalW, and shading was done using BoxShade. The 3 letter codes are as follows:...
Click to read more »File:Pbio.0060231.g002 (14157797223).png
Senin, 2026-03-16 06:38:57for putative plant proteins related to POL were aligned and then used in ClustalV. Ten thousand bootstrap replicates were performed. Rice PP2Cs with low...
Click to read more »File:Human CXorf65 Distant Ortholog MSA.png
Minggu, 2022-12-18 16:13:22Multiple sequence alignment of distant human CXorf65 orthologs made using ClustalW. Sequences include: H. sapiens (Humans, NP_001020436.1) = Hsap, R. temporaria...
Click to read more »File:Pbio.1000391.g003 (14114568116).png
Sabtu, 2026-02-07 11:33:43in DIVb (positions 755–2290 of TeI4h). RNA sequences were aligned with ClustalX [49], and the alignment was refined manually and used as input for Phylip...
Click to read more »File:1-s2.0-S1567134813003729-gr4 (14426571492).jpg
Rabu, 2025-08-13 02:16:59tree (bootstrap n = 1000; Poisson correction) was constructed based on a ClustalW alignment of the VgrG amino acid sequences from the APEC T6SS loci and...
Click to read more »File:OPSR.Roni.Fig4.v2.png
Kamis, 2025-02-13 06:41:04Euroniviridae and Roniviridae). The amino acid sequences were aligned in ClustalW and then adjusted manually to reflect predicted conserved motifs in seven...
Click to read more »File:Hemagglutinin-alignments.png
Senin, 2020-09-07 09:31:38and the bottom by residue chemical properties. Alignment produced with ClustalW. Date 19 July 2006 Source Own work Author Opabinia regalis Permission...
Click to read more »File:OTR evolutionary tree.gif
Rabu, 2020-09-23 01:51:51respective ligands is shown and has been prepared by sequence alignment using ClustalW. Receptor clusters for , isotocin and mesotocin are indicated in dark...
Click to read more »File:OPSR.Roni.Fig3.v4.png
Selasa, 2021-05-25 14:47:13Likelihood phylogenetic tree inferred in MEGA 7.0 (Kumar et al., 2016) from a ClustalW nucleotide sequence alignment of a 661nucleotide region of ORF1b for 21...
Click to read more »File:Fpls-05-00179-g001 (14444289953).jpg
Senin, 2024-09-02 13:58:14shading. The rooted Neighbour–Joining tree was obtained in MEGA 5.0 with Clustal W alignment using the full length amino acid sequences (details in Supplementary...
Click to read more »File:Alignment.jpg
Selasa, 2023-08-01 21:02:55four different hemoglobin protein sequences. The alignment made by using ClustalW WWW Service at the European Bioinformatics Institute (http://www.ebi.ac...
Click to read more »File:1-s2.0-S0020751913002750-gr2 (14244675787).jpg
Senin, 2024-11-04 23:01:12the identified R. sanguineus nAChR subunit. Sequences were aligned using ClustalX2. The phylogenetic tree was constructed using protein sequences with the...
Click to read more »File:The-Metagenomic-Telescope-pone.0101605.g003.jpg
Senin, 2025-03-31 03:33:070101605.g003.jpg English: Panel A shows an alignment (created by ClustalW) between the mouse dUTPase sequence (cyan) and the novel hit associated...
Click to read more »